Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 1 (SCARNA1) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 1 (SCARNA1) URS000021BC29_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA1: SCARNA1 is a small Cajal body-specific RNA (scaRNA) that targets U2 snRNA and is involved in snRNA function in human primary cell cultures [PMC6023535]. SCARNA1 is located within the fifth intron of the ppp1r8b gene [PMC6023535]. SCARNA1, along with other scaRNAs, such as scarna8, SCARNA13, SCARNA14, and scarna2, carries out U2 snRNA modifications [PMC6023535]. In patients with frontotemporal lobar degeneration (FTLD), the TDP-43 protein binds more strongly to SCARNA1 compared to healthy individuals [PMC4054096]. SCARNA1 levels were undetectable in certain samples of extracellular vesicles (EVs) derived from peripheral blood [PMC9267956]. In individuals with Tetralogy of Fallot (TOF), a congenital cardiac defect, SCARNA1 was found to be downregulated and its loss dysregulated the splicing of important regulators of heart development [PMC9862068]. The levels of certain miRNAs and lincRNAs were also found to be regulated by NTHi infection and interaction with other RNA molecules [PMC4659474] [PMC10023947]. Dyskerin depletion resulted in reduced levels of U17, U64, and SCARNA1 in cells expressing wildtype dyskerin compared to empty vector cells expressing dyskerin-depleted cells [PMC6547437]. The pseudouridylation guide capacity of the 3'-terminal guide loop of SCARNA1 was demonstrated through various experiments using mutant RNAs and CRISPR-Cas9 genome editing techniques [PMC8763049].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCACUUGAUACUAACCGAGCUGUCUAUAUCCUAGCCUUGUGUCAAAGGCUUGUGAUGUGUUGUGAUAGCUGGGUUUAAGAAGUGCAAUAUUAAAACAAAAGCCAUGAGUCUUUUAAGCCCAGUGUGUAAAGAUACACUCUGAGUUAUAACUCAGAGGCACAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications