Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 36C (SNORD36C) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 36C (SNORD36C) URS0000215639_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD36C: SNORD36C is a small nucleolar RNA (snoRNA) that is significantly associated with the expression levels of its host transcript, ribosomal protein L7A (RPL7A), in HD tumors [PMC3511933]. The upregulation of SNORD36C in HD samples is consistent with the global upregulation of the translational machinery, including genes involved in protein biosynthesis [PMC3511933]. SNORD36C is also found to be upregulated in TC2 patients, likely due to its representativeness within HD cases [PMC3511933]. SNORD36C is located on a chromosomal region that has been reported to be transcriptionally active or specifically downregulated in HD patients [PMC3511933]. In hepatocellular carcinoma (HCC), high expression levels of SNORD113-1, a snoRNA similar to SNORD36C, are associated with shorter time to relapse [PMC8677010]. In a study on multiple myeloma (MM), SNORD36C was found to be downregulated in a molecular subgroup of MM patients known as TC2, along with its host gene TAF1D [PMC8629011]. These findings suggest that snoRNAs like SNORD36C may play a role in the overall upregulation or downregulation of the translational machinery and have potential prognostic value in cancer [PMC8629011] [PMC8677010] [PMC3511933].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCCAAUGAUGGUUAAGAAUUUCUUCACCUGAAUAAACCAUGUGGUCAGCAUUGCAUCUGAGGCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes Small nucleolar RNA SNORD36
2D structure Publications