Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30b-3p URS00002152A8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30b: Hsa-mir-30b is a microRNA that has been shown to target genes Beclin-1 and ATG5 [PMC3885199]. This finding was confirmed by a study that used TaqMan assays to analyze miRNAs [PMC7177752]. The TaqMan assays specifically targeted hsa-mir-30b, hsa-miR-200c, hsa-miR-203a, and U6 [PMC7177752]. The study's results provide evidence for the role of hsa-mir-30b in regulating the expression of Beclin-1 and ATG5 genes [PMC3885199]. These findings are significant as Beclin-1 and ATG5 are involved in autophagy, a cellular process important for maintaining cellular homeostasis and preventing the accumulation of damaged proteins and organelles [PMC3885199]. The regulation of autophagy by hsa-mir-30b suggests its potential role in modulating cellular processes related to cell survival, development, and disease progression [PMC3885199]. Further research is needed to fully understand the mechanisms by which hsa-mir-30b regulates Beclin-1 and ATG5 expression, as well as its broader implications in cellular physiology [PMC3885199][PMC7177752].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGGAGGUGGAUGUUUACUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Alligator mississippiensis ami-miR-30b-3p
  2. Capra hircus (goat) chi-miR-30b-3p
  3. Chrysemys picta cpi-miR-30b-3p
  4. Dasypus novemcinctus dno-miR-30b-3p
  5. Macaca mulatta mml-miR-30b-3p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-3p
Publications