Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNF32 antisense RNA 1 (ZNF32-AS1) URS000021438E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZNF32-AS1: ZNF32-AS1 is an antisense gene that has been identified as a prognostic biomarker in multiple myeloma (MM) [PMC9194958]. In a study, 42 prognostic DEnrlncRNAs, including ZNF32-AS1, were identified based on univariate Cox regression analysis [PMC9194958]. Furthermore, the study found that ZNF32-AS1 was one of the 12 DEnrlncRNAs that outperformed in constructing the NerRLsig [PMC9194958]. Another study also identified ZNF32-AS1 as a potential biomarker in MM [PMC6628062]. In addition to ZNF32-AS1, other antisense genes such as FAM83C-AS1, TMC3-AS1, and TAT-AS1 were also found to have biomarker potential in MM [PMC6628062]. Furthermore, the study identified several long intergenic noncoding RNAs (LincRNAs) and microRNAs with potential biomarker roles in MM [PMC7549345]. Although ZNF32-AS1 has not been previously reported to be related to acute myeloid leukemia (AML), its role in other tumors has been identified [PMC7388210]. Therefore, it is suggested that ZNF32-AS1 might also influence the prognosis of AML [PMC7388210]. Additionally, another study used twelve genes including ZNF32-AS1 to build a risk model for an unspecified disease. The risk score was calculated based on the coefficients of these genes [PMC8755759]. In summary, ZNF32-AS1 is an antisense gene that has been identified as a prognostic biomarker in multiple myeloma and potentially acute myeloid leukemia. It is part of a group of DEnrlncRNAs that have shown promise in predicting prognosis in MM. Furthermore, ZNF32-AS1 has been found to have potential biomarker roles in other tumors as well.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAGACAUUUAUUUUUCAUACUCUUUUGGGGGAAAGGAAAAAAAUCAGUUUGCCCUACCCAAUGAUGGUCUUUCUGAAAGAUUCUCCAUUCAUUCCAUAGAACUGGAUAGGUUGCUUCAUCUCAGAGGAUUUUGUACUCUUAAUUCAUAAAGAGAACUUCUCUUCAGGAAAGUGGUCAAAGGGUGAGCCUCUGUGAGCAGCUUCGCUGGUGCACAGCCAGACUCCCUCUCUGGUUAGAAUAGGGAAAAAGAAACAUAAUACUUUGAGUGCUUAUGAUGUGCCAGGCCUUAUUCUUUGCAUAGACAAUGCAAUCCUGAAAACAAUGCCAUGAGAGUGAUACAGAUAAUGGGAGCAAAGGGAGCCUGUCAAAGGUCACAGAGCUAGGUAAGUUAGAGCUGACUCAAAUAGGCAUUCUCCAUAGCAGUGUACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications