Homo sapiens (human) HOXC cluster antisense RNA 3 (HOXC-AS3)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HOXC cluster antisense RNA 3 (HOXC-AS3) URS0000207271_9606

368 nucleotides
10 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 1 other species
93 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HOXC-AS3: HOXC-AS3, a long non-coding RNA (lncRNA), is predominantly expressed in the cytoplasm of glioma cells [PMC8984117]. It has been shown to interact with Y-box binding protein-1 (YBX1) in gastric cancer cells and non-small cell lung cancer (NSCLC) cells [PMC8986809]. Upregulation of HOXC-AS3 is associated with pro-growth effects and is linked to the expression of HOXC10 [PMC7506549]. HOXC-AS3 regulates gastric cancer cell proliferation and migration through its interaction with YBX1 [PMC7251172]. HOXC-AS3 is upregulated in gastric cancer and other cancer types, but its exact role in tumorigenesis remains unclear [PMC6172843]. The methylation and genomic location of HOXC10 and HOXC-AS3 have been visualized [PMC7506549]. Knockdown of HOXC-AS3 leads to G1 arrest of hepatocellular carcinoma (HCC) cells, as it accelerates the shift from G1 to S-phase and downregulates CDK2 expression [PMC9420287].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CGAUAGGCGGCUUUGGGGUCGCCCCAGGAGUCCAGCUGCGAGAGACCAAUGGGAUUUGAAAAUGGCCUUGAUGAUUCAGACGGCCGUGACGUCAGCGGGGUCAAGUUGUCGGCAGGCGGAGCGCGCAGAGUGGAGUAACAGCGCCAUCUAGCAGCUGCCUCGGGGGAAUAUUCCGGGAAAGAAAGAGGGAACCUGCGGAGCCUCGGUCAGUUUGGAGGAGUCACGUAUCACACGGGAAACCAGCACACAAGACGCAACAAAACCCGACCCAGAGAAGCGUCCUUUACAGAGCGCACGGGCUGGGAGCAUGUUUGAAAGAAGACAGACCAGUCUAUUUUUGUGGUUGUUUUUAAAUAAAAGGAAGAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Pan troglodytes (chimpanzee) antisense RNA

Publications