Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-136-3p URS0000204177_9606

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCAUCGUCUCAAAUGAGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus Bta-Mir-136-v1_3p (mature (guide))
  2. Canis lupus familiaris Cfa-Mir-136-v1_3p (mature (guide))
  3. Cavia porcellus cpo-miR-136-3p
  4. Dasypus novemcinctus dno-miR-136-3p
  5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-136-v1_3p (mature (guide))
  6. Macaca mulatta Mml-Mir-136-v1_3p (mature (guide))
  7. Microcebus murinus (gray mouse lemur) mmr-miR-136
  8. Mus musculus (house mouse) Mmu-Mir-136-v1_3p (mature (co-guide))
  9. Oryctolagus cuniculus ocu-miR-136-3p
  10. Otolemur garnettii oga-miR-136
  11. Pteropus alecto pal-miR-136-3p
  12. Rattus norvegicus (Norway rat) rno-miR-136-3p
  13. Sus scrofa ssc-miR-136-3p
Publications