v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) POTEF antisense RNA 1 (POTEF-AS1) URS00001FFF0A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

POTEF-AS1: POTEF-AS1 is a long non-coding RNA (lncRNA) that is regulated by the androgen receptor (AR) and is involved in apoptosis and toll-like receptor signaling pathways [PMC7749978]. It interacts with TLR3 and TNFSF10, which are important in apoptosis and growth arrest [PMC7749978]. The up-regulation of POTEF-AS1 by androgens has been shown to promote the survival of prostate cancer cells by affecting apoptosis-associated pathways [PMC8619311]. Specifically, POTEF-AS1 promotes the growth of prostate cancer cell lines (LNCaP and LTAD) by targeting TNFSF10, a pro-apoptotic protein ligand, and TLR3, which triggers apoptosis [PMC6056913]. This effect is partially mediated through the inactivation of the PI3K/Akt signaling pathway [PMC6056913]. References: - [PMC7749978]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7749978/ - [PMC8619311]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8619311/ - [PMC6056913]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6056913/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGUUGUGUGCUUCGUAUGAGAAUCUAAUGCCUGAUGAUCUGUCACUGUCUCACUUUGCCCCCAGAUGAGACCAUCCAGUUGCAGAAAAAUAAGUUCAGAGCUUCCACGGAUUCUACAUUAUGGAUAUGUGCCGCCGAAGCAAGCACAAAGCCCUACUUUUACAUAUGAUUAGUGAUGCGUCAUGGACAAGGCUUGGCUCUGUGAAGUCCAACUAACCUACUUGAGAUUCUGAGAAUUCUCUUCAAUGGCUUCCUGUGAGCUAGAGUUUGAAAAUAUCUUAAAAUCUUGAGCUAGAGAUGGAAGUAGCUCCGAUAAUUUUCAUUAUCAUGUAAAUCAGAUCACUCAAGGGGCCAACCACAGCUGGGAGCCACUGCUCAGGGCAAGGUUCAUACGGGACUUUCUACUGCCCAAGGUUCUAUACAGGAUAUAAAGGUGCCUCACAGUACAGAUCUGGUAGCAAAGAGGAAACAGACACUGACCUCCUUCUGCCACAUUAUUUGAACCCCUCUCACCCUUUAGAACAAGCCCACCUAACAUCUGCCAGAGAAAAGACCAACAACAGCCUCAAAGGAUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications