Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 79 (SNORD79) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 79 (SNORD79) URS00001FCA45_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD79: SNORD79 is a small nucleolar RNA (snoRNA) that is encoded within the Small Nucleolar RNA Host Gene 2 (SNHG2) or Growth Arrest Specific 5 (GAS5) gene located in the 1q25.1 region. GAS5 is a noncoding gene that contains multiple snoRNAs, including SNORD79, SNORD78, SNORD44, SNORD77, SNORD76, SNORD75, and SNORD74 [PMC9598326] [PMC9219770]. These snoRNAs are predicted to regulate the 2’O-methylation of rRNA and contribute to pseudouridylation [PMC8658237]. The GAS5 gene also contains other snoRNAs such as SNORD81 and SNORD47 [PMC9219770]. The introns of GAS5 host several box C/D snoRNAs including SNORD79 [PMC6856654]. Additionally, the nucleolar reads of GAS5 intronic snoRNA loci include SNORD79 [PMC4159348]. The expression of SNORD79 is affected by splicing differences observed between different cell types [PMC6965107]. Furthermore, changes in the target nucleotides of 2’-O-methylation have been observed for downregulated snoRNAs such as SNORD79 in certain conditions [PMC9696202]. The methylation status of specific target nucleotides for differentially expressed snoRNAs including SNODR79 has been analyzed using reverse transcription termination method [PMC9696202]. References: - PMC9598326 - PMC9219770 - PMC8658237 - PMC6856654 - PMC4159348 - PMC6965107 - PMC9696202

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUUAGUGAUGAUUUUAAAAUUAAAGCAGAUGGGAAUCCCUCUGAGAAAGAAAAUGGAGAUUAAUCUUAAACUGAAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications