Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Asp (GAU/C) (MT-TD) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Asp (GAU/C) (MT-TD) URS00001FC4D3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TD: MT-TD is a mitochondrial gene that codes for the tRNA for aspartic acid. It has been found to have two ancient mutations [PMC7514063]. In addition to its coding function, MT-TD has been identified as one of the top 10 noncoding regulators for ulncRNAs [PMC9127114]. MT-TD is one of several mitochondrial genes that have been implicated in various diseases, including multiple sclerosis [PMC7611844]. It is also part of a group of genes that are downregulated in grade 3 tumors [PMC9777612]. MT-TD is located on the H-strand of the mitochondrial genome, along with several other tRNA genes [PMC9657367]. Modifications have been identified at specific positions within MT-TD, including m1A at position 9 and Ψ modifications at positions 27 and 28 [PMC9308231]. The precursor RNA for MT-TD has been found to be processed in the absence of RNase P, resulting in a predominant processing intermediate that includes mt-Co1 and MT-TD [PMC5435911]. PCR amplification has been used to study specific regions within the mitochondrial genome, including MT-TD [PMC3812239]. Hypomethylation of mtDNA genes such as MT-TA, MT-TN, and MT-TC has been associated with hypermethylation of MAT and DNMT in nDNA [PMC5645762]. In multiple sclerosis, two novel mtSNV associations have been identified with m.7559A>G in MT-TD and rs2853826/m.10398A>G [PMC7611844]. Hypomethylation has also been observed in genes involved in protein synthesis during translation such as MT-TC and mitochondrially encoded tRNA serine 1 (MT-TS1), as well as cytochrome c oxidase genes (MT-CO1 and MT-CO2) [PMC5645762].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGUAUUAGAAAAACCAUUUCAUAACUUUGUCAAAGUUAAAUUAUAGGCUAAAUCCUAUAUAUCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cloning vector pRS316-1B9 tRNA-Asp
2D structure Publications