Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-125a-3p URS00001F0C23_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-125a: Mmu-mir-125a is a microRNA that inhibits the proliferation of hepatocellular carcinoma, laryngeal squamous cell carcinoma, endometrial cancer cells, and increases stem cell quantities by targeting BAK1 [Bi et al., 2012; Jiang, 2011; Sun et al., 2017; PMC6829453]. It is also involved in the impairment of autophagy function in Ewsr1 knockout MEFs and mice by reducing the expression of the Uvrag gene [PMC4989891]. In addition, mmu-mir-125a is one of the most abundant miRNAs expressed in mice cortex samples [PMC6206094]. Mmu-mir-125a belongs to a group of miRNAs that are overexpressed during the development of primordial germ cells, along with mmu-miR-17-92 cluster, mmu-let-7, and mmu-miR-9 [PMC9505168]. References: Bi et al., 2012: https://pubmed.ncbi.nlm.nih.gov/22848692/ Jiang et al., 2011: https://pubmed.ncbi.nlm.nih.gov/21660939/ Sun et al., 2017: https://pubmed.ncbi.nlm.nih.gov/28572517/ PMC6829453: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6829453/ PMC4989891: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4989891/ PMC6206094: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6206094/ PMC9505168: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9505168/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGGUGAGGUUCUUGGGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Publications