Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-374b-3p URS00001EFEC1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-374b: Hsa-mir-374b is a member of the mir-374 family of microRNAs. In a study, it was found that the expression of hsa-mir-374b was upregulated in the propofol group after H/R treatment, which was in agreement with the result of microarray hybridization [PMC8986434]. Additionally, hsa-mir-374b was identified as one of the miRNAs with low expression in osteosarcoma (OS) patients that have a poor prognosis [PMC9553349]. Hsa-mir-374b also showed a high dependency on hsa-miR-99b, hsa-miR-186, hsa-miR-28, and hsa-miR-32 [PMC9525704]. Furthermore, it was found that hsa-mir-374b is one of the miRNAs significantly enriched with targets in a list of CP genes [PMC6604454]. In an experimental study, A549 or H1792 cells were transfected with an hsa-mir-374b mimic to investigate its effects [PMC7409139]. Overall, these findings suggest that hsa-mir-374b plays a role in various biological processes and may have implications for disease prognosis and treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUAGCAGGUUGUAUUAUCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications