Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-146a-3p URS00001EFBE3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-146a: Hsa-mir-146a is a microRNA that has been the focus of several studies. One study aims to validate the miRNA-target relationships involving hsa-mir-146a, hsa-miR-148a, and BRCA2, and investigate the impact of miRNA deregulation on sensitivity to platinum-based chemotherapy using wet experiments on cell lines and clinical samples [PMC4385859]. Another study suggests that a closely related hsa-mir-146a regulates IRAK1 in PTC [PMC5021476]. Lentiviruses containing hsa-mir-146a and a negative control were obtained from Shanghai Jikai Gene Chemical Co., Ltd. [PMC5779957]. The expression of hsa-miR-21 and hsa-mir-146a is influenced by the NF-κB signaling pathway [PMC9198802]. Hsa-miR-193b, hsa-miR-29c, hsa-miR-613, hsa-miR-206, hsa-miR-128, and hsa-mir-146a are potential circulating AD biomarkers [PMC8538213]. Three common miRNA SNPs located in the pre-miRNA regions of different microRNAs were selected for genotyping in a study, including one in the pre-region of hsa-mir-146a [PMC4726409]. HSA-MIR526A positively regulates type I interferon production to inhibit EV71 replication by targeting CYLD. HSA-MIR548 suppresses host antiviral responses by targeting IFN-lambda1 to promote EV71 infection. The upregulation of HSA-MIR146A induced by EV71 targets IRAK1 and TRAF6 associated with TLR signaling pathway and type I interferon production [PMC6130220]. HSA-MIR1425P and HSA-MIR146A are enriched in the germinoma group, while 19 miRNAs are enriched in the NGMGCT group [PMC2837036]. RT-qPCR was performed using TaqMan Advanced miRNA Assays, including hsa-mir-146a [PMC8645370].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGAAAUUCAGUUCUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications