RNU6-2: RNU6-2 is a small nuclear RNA (snRNA) that is commonly used as a control in various molecular biology techniques [PMC5190102]. It is frequently employed as a reference gene to normalize for variability in sample loading and real-time RT-PCR efficiency [PMC7764659]. In studies comparing different samples, RNU6-2 has been used alongside other small nuclear RNA housekeeping genes, such as Snord61, Snord68, Snord72, Snord95, and Snord96a [PMC4629002]. RNU6-2 has also been utilized as an endogenous control to normalize the expression levels of investigated miRNAs in studies involving miScript primer assays [PMC5141468]. In these assays, RNU6-2 was compared to other endogenous controls like U6 [PMC8567754]. Overall, RNU6-2 plays an important role in ensuring the accuracy and reliability of gene expression studies by serving as a reference or control gene. Its stability and consistent expression levels make it a suitable choice for normalization purposes. Researchers often rely on RNU6-2 to account for technical variations and ensure that the results obtained are reflective of the biological differences being investigated.
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.