v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2268 (LINC02268) URS00001E60D9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02268: LINC02268 is a long non-coding RNA (lncRNA) that has been identified in several studies as being associated with the progression of various types of tumors, including clear cell renal cell carcinoma (ccRCC) and gastric cancer (GC) [PMC8546190] [PMC8479203]. In a study on ccRCC, LINC02268 was found to be one of the four lncRNAs (along with MNX1-AS1, AC013391.3, and AC122710.3) that were associated with tumor progression and showed significant correlation with tumor grade, stage, and T stage [PMC8546190]. Furthermore, LINC02268 was found to be part of a genomic instability-derived lncRNA signature (GILncSig) that could predict clinical outcomes in ccRCC patients [PMC8546190]. In the context of GC, LINC02268 was identified as one of the lncRNAs included in a competing endogenous RNA (ceRNA) network. This network consisted of four lncRNAs (LINC01644, LINC01537, LINC01697, and LINC02268), six miRNAs, and 88 mRNAs [PMC8479203]. The study showed significant differences between overall survival and differentially expressed lncRNAs in the ceRNA network including LINC02268 [PMC8479203]. Overall, these findings highlight the potential role of LINC02268 as a biomarker for tumor progression and clinical outcomes in ccRCC and GC patients.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUACAGUACAGAUCUCUGUACUGUAAACGACAACAAGGACCAGUCACAAUUUCAGUUCUUGUUACAUUGAUAAGACUCCUUCAGAAAGCAAUGAAGAGAAAAGCUGAAGUCAGUGAUUAGGAGUGUCUGUGUAAGUAAAAGCAACAGGCAAUUACUGAGUGUGGUGUGAGAGGCACGGAAAGAUUGGGAAUUCAGCAAGAAGAGGAAUUGAAGUCAAACCUCACCUACUUCCCAGAGUCUUCUGGAUUUUCUGUUAGAAGCUUCAGUAUCUGAGGAAAGGACUCAGGCAACAAAUAAACAGCUAAGAUUUUACUAGAGUAUGAAAGGGAGAGCACUGGAGUGCAGUGCGGGGAUGGAGAUGCAGCUGUGGUGGCUGGAAGUACAGGAGGGCAGCUGGAGGCACCUGGCCUCUGAAGCCUGUCUUCUUCAUCUGGGUGAGAUCUGCUGGAGUCAGGAAGGACUUCCUGCUGCAAGGAUAAAGACCUAAGAAGCAUCAUGACCUGAGAAACAGUUUCACAGGCCACUCUUGGCAGGUGAAGUGUGGUGGCGUAAUCAUGACUCACUGCAGCCUCGAACUCCGGGACUCAAGCUAAUCUCUUUCCUCAGCCUUCCCAGCAGCUGGGACUACAGGUAUAUGCCACCAAACCUAGCUAACAUUUUAAAAAAUUUUUUCUUUUGUAGAAACGGGGUCUUGCUAUGUUGACCAGGCUGGUUUUAAACUCCUUGCCUCAAGUGAUCCUCCCAUCAUUGCCUCCCAAAGUCUUGGGAUUACAGGCAUGAGCCACUGCGCCCAGCUACAAUAUAUUUUGGAUGCUGACUUUAUAUCCUGUGACUUUGCUAUGGUCGCUUAUUAUUUCUAGACAUUUUUGUUUUUGACAGAGUCUCACUGUUUUGCUUAGGCUGGAGUGCAGUGGCACAAUCUUCAUUCACUGCAACCUCUGCCUCCUGGGUUCAGGCUAUUCUCCUGCCACAGCCUUCAGAGUAGCUGGGACUGCAGGCACGCAACACCAUGCCCGGCUAAUUUUUGUAUUUUUAGUAGAGACAGGGGAAUCACGAUGUUGGUCAGGCUGGUCUCGAACUCCUGACCUCAAGUGAUCUGCCUGCCUCGGCCUCCCAAAGUGUUGGAAUUACAGGCGUGAGCCACCAUGCCUGGCCACGGUUUUUUUGAUCCUUUAGGAUUUUCUACCAAGACUGUCAUGUCAUCUAUAAUCAAGUACUCUUUUAUUUCUUUUUUUCCAAUUUGUUUGUAUUUUAUUUCUUUUUUCUCAAAGCUUAUUGUACUGACUAAGAUCCCCAGAAUAAUGUUGAAUAAAAGUAUUGGAAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications