Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-127-3p URS00001E3DAA_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-127: Mmu-mir-127 is a pri-miRNA that has been studied in various contexts. It was included in a panel of pri-miRNAs that were used to generate digoxigenin-labeled RNA-probes [PMC7904729]. Mmu-mir-127 has been reported to reside in imprinted loci in the genome and is expressed from the maternally inherited chromosome [PMC3712712]. It was omitted from further analysis due to the lack of identified targets [PMC9657954]. Mmu-mir-127 was included in a panel of TaqMan miRNA assays used for mice [PMC9657954]. In a study on lung development, overexpression of mmu-mir-127 led to impaired lung branching, indicating its essential role in lung development [PMC9657954][PMC4065842][PMC9321239]. The chr12qF1 microRNA cluster, which includes mmu-mir-127, has been found to be up-regulated in various cancer subtypes, including lung adenocarcinoma and colorectal cancer [PMC4989891][PMC4065842][PMC9321239]. The downregulation of mmu-mir-127 has been associated with upregulation of MAPK pathways [PMC9321239]. Mmu-mir-127 expression was found to be low or undetected in B cells that had experienced the germinal center (GC) reaction, suggesting its downregulation during B-cell differentiation and exit from the GC [PMC3432484][PMC3432484][PMID3432484].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (cattle) bta-miR-127
  3. Canis lupus familiaris cfa-miR-127
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus (red deer) cel-miR-127
  6. Cricetulus griseus (Chinese hamster) cgr-miR-127
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-127
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-127
  11. Homo sapiens (human) hsa-miR-127-3p
  12. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  13. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  14. Macaca nemestrina mne-miR-127
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-127
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  19. Pan troglodytes ptr-miR-127
  20. Papio hamadryas pha-miR-127
  21. Pongo pygmaeus ppy-miR-127
  22. Pteropus alecto pal-miR-127-3p
  23. Rattus norvegicus rno-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications