Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-137-3p URS00001E3523_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-137: Mmu-mir-137 is a microRNA that has been studied in various contexts. It has been shown to be differentially expressed in BM-infiltrating and primary tumors [PMC4537015]. Mmu-mir-137 has also been used in transfection experiments, where a mimic of mmu-mir-137 was transfected into cells [PMC4506960]. Reverse transcription reactions and real-time PCR have been used to measure the expression of mmu-mir-137 [PMC4288926]. Mmu-mir-137 has also been studied in the context of its binding site on the CDC42 3'-UTR and its role in preventing binding to targets [PMC4648110] [PMC5905159]. It has been found that mmu-mir-137, along with other miRNAs, targets genes such as Luzp1 and Mtmr4 [PMC9106358]. Primer sequences have also been designed for mmu-mir-137 for further analysis [PMC2854370]. Mmu-mir-137 is one of the highly expressed miRNAs in neuronal cultures and is not differentially regulated [PMC2759968]. The expression level of putative mmu-mir-137 target genes has been found to be altered in various brain regions such as mPFC, striatum, thalamus, hippocampus, and cerebellum [PMC6667145]. The target genes of mmu-mir-137 have also been predicted using multiple databases [PMC6667145]. Hsa-miR-137 is strongly expressed in humans while mmu-miR-137 is strongly expressed in mice brain tissue. MiR-665 is not well characterized yet. MiRIDIAN miRNA mimic negative control was used as a control for experiments involving mmu-miR124a and mmu mir 37 mimics. The microRNAs used in the study were purchased from Ambion, Inc. [PMC9169915] [PMC3462785] [PMC2443372] [PMC2904378].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUUGCUUAAGAAUACGCGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis Ami-Mir-137-P1-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-137a
  3. Bos taurus (cattle) bta-miR-137
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-137
  5. Callorhinchus milii (elephant shark) Cmi-Mir-137-P1_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-137-P1-v1_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-137-P1-v1_3p (mature (guide))
  8. Chrysemys picta cpi-miR-137a-3p
  9. Columba livia (rock pigeon) cli-miR-137a-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-137-3p
  11. Cyprinus carpio (common carp) ccr-miR-137
  12. Danio rerio Dre-Mir-137-P1b-v1_3p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-137-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-137-P1-v1_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-137
  16. Gadus morhua (Atlantic cod) Gmo-Mir-137-P1b-v1_3p (mature (guide))
  17. Gallus gallus Gga-Mir-137-P1-v1_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-137-P1-v1_3p (mature (guide))
  19. Homo sapiens (human) hsa-miR-137-3p
  20. Ictalurus punctatus ipu-miR-137
  21. Latimeria chalumnae (coelacanth) Lch-Mir-137-P1_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-137-P1-v1_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-137-3p
  24. Microcaecilia unicolor Mun-Mir-137-P1_3p (mature (guide))
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-137-P1-v1_3p (mature (guide))
  26. Monopterus albus Mal-Mir-137-P1b-v1_3p (mature (guide))
  27. Oreochromis niloticus oni-miR-137a
  28. Ornithorhynchus anatinus (platypus) oan-miR-137a-3p
  29. Oryctolagus cuniculus (rabbit) Ocu-Mir-137-P1-v1_3p (mature (guide))
  30. Pan troglodytes ptr-miR-137
  31. Pongo pygmaeus ppy-miR-137
  32. Python bivittatus pbv-miR-137a-3p
  33. Rattus norvegicus rno-miR-137-3p
  34. Sarcophilus harrisii Sha-Mir-137-P1-v1_3p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-137-P1_3p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-137-P1_3p (mature (guide))
  37. Sus scrofa ssc-miR-137
  38. Taeniopygia guttata tgu-miR-137-3p
  39. Xenopus laevis Xla-Mir-137-P1_3p (mature (guide))
  40. Xenopus tropicalis Xtr-Mir-137-P1_3p (mature (guide))
Publications