Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Caenorhabditis elegans lin-4 stem-loop (cel-lin-4) secondary structure diagram

Caenorhabditis elegans lin-4 stem-loop (cel-lin-4) URS00001E2999_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-lin-4: Cel-lin-4 is a specific type of RNA found at high levels in young adult hermaphrodites [PMC3282659]. Its levels can be affected by adult age [PMC3282659]. In a study, 1 fmole of two Mimic RNA Spike-in, including cel-lin-4, was added to serum samples to normalize the differences in RNA isolation efficiency [PMC7801652]. To isolate RNA from the serum, 300 μL of serum was homogenized in 900 μL of Trizol LS with the addition of 6 μL of cel-lin-4 [PMC4951333]. Cel-lin-4 was also used as a negative control in experiments as it shows no expression in human tissue [PMC2383925]. The expression levels of miRNA-29c were normalized to that of cel-lin-4 using a specific equation [PMC3696003]. Negative controls including ath-mir159a, cel-miR-2, and cel-miR-124 were used to ensure specificity [PMC1874652]. In another study, recombinant cel-lin-4 was added to samples and no significant differences were found among different groups, thus another control (cel-miR39) was used for normalization purposes [PMC4648542]. The expression levels of miRNAs were calculated using the ΔΔCt method [PMC5641166].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCUUCCGGCCUGUUCCCUGAGACCUCAAGUGUGAGUGUACUAUUGAUGCUUCACACCUGGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications