v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GK intronic transcript 1 (GK-IT1) URS00001DEBB7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GK-IT1: GK-IT1 is a long non-coding RNA (lncRNA) that has been found to be negatively correlated with overall survival in various cancers, including osteosarcoma (OS) and gastric cancer (GC) [PMC7748909] [PMC8063256] [PMC6781732]. In OS, GK-IT1 is considered a risk factor for prognosis [PMC7748909]. In GC, GK-IT1, along with other lncRNAs such as LINC00501 and SOX21-AS1, has been identified as a potential diagnostic biomarker and may be functionally associated with GC development and progression [PMC8063256]. GK-IT1 has also been reported to be positively associated with overall survival in patients with esophageal adenocarcinoma [PMC8063256]. Additionally, GK-IT1 may be involved in the cell cycle by targeting mRNA CCNB1 via miR-24-3p [PMC8063256]. In colorectal cancer (CRC), GK-IT1 is part of a 6-lncRNA model for predicting metastasis along with other lncRNAs such as HOTAIR and LINC01602 [PMC7068734]. However, the specific mechanisms of GK-IT1 in CRC metastasis remain unclear [PMC7068734]. Furthermore, GK-IT1 has significant correlations with the prognosis of patients with CRC metastasis [PMC7068734].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUUAUGCUUAUCUGACAGAAGGUUUGUUGAUUUCAAGUCACUAGGAACAGUGCCUCCAAAAUUAAAAUUCACUCUCCAACUGAGCAGCACACACUAGCUCAAGGCAAUUAAAUAGACUGCUUCUUUCCUUCUAGCGGUAGAGUCAGCUCUGUUUGCCUGUCACUGGGCUCAAGGAAUUACAAAGUAUAAAGAGUUACAGUAGCAAUUCCAAAAUACAAAGAGUUACGGCUGGGCAUGGUGGCUCACACCUGUAAUCCCACUACUCAGGAGGCUGAAGCAGGAAAAACGCUUGAACCCAGGAGGCAGAGGUAGCAGUGAGCCAAGAUCACGCCGAGCCGAGAUCAUGCCAUUGUACUCCAGCCUGGGCAACAAGAGCAAAACUCCAUCUCAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications