Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30e-5p URS00001DE669_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-30e: mmu-mir-30e is a type of microRNA that is downregulated in affected tissues [PMC3641397]. This downregulation was validated through qRT-PCR analysis of apoE−/− and B6 aortic tissue microarray results [PMC3641397]. In the type 2 diabetes pathway, mmu-mir-30e, along with mmu-miR-30a and mmu-miR-19b, has a functional role in indirectly regulating SOCS3 in ASVD [PMC3641397]. The expression levels of mmu-mir-30e were significantly lower in apoE−/− aortic tissues compared to healthy controls [PMC3641397]. Among the downregulated miRNAs, mmu-mir-30e showed the largest decrease in expression [PMC3641397]. Mmu-mir-30e has been shown to be involved in transcript degradation and translational inhibition or enhancement in various tissues [PMC5020804]. In the brains of calorie-restricted (CR) mice, mmu-mir-30e exhibited significant downregulation compared to ad lib-fed mice [PMC3091518]. However, there was no age-dependent upregulation of mmu-mir-30e in CR animals compared to ad lib-fed controls [PMC3091518]. Mmu-mir-30e was also transfected into cells as part of an experiment investigating its effects on gene expression [PMC3091518]. Mmu-mir-30e has been implicated in Wnt signaling and adipogenesis by previous studies [PMC9192975].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUUGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Danio rerio (zebrafish) dre-miR-30e-5p
  2. Equus caballus eca-miR-30e
  3. Homo sapiens (human) hsa-miR-30e-5p
  4. Macaca fascicularis (crab-eating macaque) microRNA miR-30e-5p
  5. Macaca mulatta (Rhesus monkey) mml-miR-30e-5p
  6. Pan troglodytes ptr-miR-30e
  7. Pongo pygmaeus ppy-miR-30e
  8. Rattus norvegicus rno-miR-30e-5p
  9. Xenopus tropicalis (tropical clawed frog) xtr-miR-30e
Publications