Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-521 URS00001DBB42_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-521: Hsa-mir-521 is a microRNA that has been studied in various contexts. It is one of the qPCR primers used in the Qiagen miScript Primer Assay [PMC4600756]. In gastric cancer, hsa-mir-521 has been identified as a target of ERCC8 [PMC7354774]. In ovarian cancer, hsa-mir-521 has been associated with tumor grade-dependent survival, with lower expression being associated with lower survival probability in high-grade tumors [PMC3595291]. Hsa-mir-521, along with hsa-miR-381, has also been found to be overexpressed in platinum-resistant ovarian cancer [PMC3595291]. In prostate cancer cells, the expression levels of hsa-mir-521 were found to be altered after radiation treatment [PMC3424689]. Additionally, hsa-mir-521 was down-regulated by H2O2 treatment in a study on oxidative stress [PMC6884596]. Consensus expression distributions were observed for hsa-miR-519a and hsa-mir-521 across different samples [PMC3120834]. References: [PMC4600756] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4600756/ [PMC7354774] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7354774/ [PMC3595291] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3595291/ [PMC3424689] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3424689/ [PM6884596] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM6884596/ [PM3120834] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM3120834/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACGCACUUCCCUUUAGAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-521 (MIR521)
  2. Gorilla gorilla (western gorilla) ggo-miR-521
  3. Pan troglodytes ptr-miR-521
  4. Pongo pygmaeus ppy-miR-521
Publications