Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1293 URS00001DABC0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1293: Hsa-mir-1293 is a microRNA that has been observed to have a tumor suppressor role [PMC7352268]. In a study, the levels of hsa-mir-1293 derived from extracellular vesicles (EVs) were found to gradually increase after tumor removal until follow-up, but were significantly decreased in the metastatic group [PMC7352268]. This suggests that hsa-mir-1293 may play a role in inhibiting tumor growth and metastasis [PMC7352268]. Additionally, a 16-miRNA signature, which includes hsa-mir-1293 along with other miRNAs (hsa-mir-2116, hsa-mir-4161, hsa-mir-3942, hsa-mir-4435, hsa-mir-1307, hsa-mir-1254, hsa-mir-582, hsa-mir-5690, hsa-mir-4713, hsa-mir939 ,hsa -mir -421 ,hsa -mir -335 ,hsa -mir -4677 ,hsa -mir -4754 and has mir 4746), has been found to have the ability to classify lung adenocarcinoma (LUAD) pathological stages similar to combinations of 42 or 26 miRNAs [PMC7138293]. This suggests that the presence or absence of these miRNAs can potentially be used as biomarkers for LUAD staging [PMC7138293]. Overall, these findings highlight the potential importance of studying and understanding the role of microRNAs like hsa mir 1293 in cancer progression and as potential diagnostic or therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUGGUCUGGAGAUUUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1293
Publications