Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1271-3p URS00001D4A78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1271: Hsa-mir-1271 is a microRNA that has been identified in various studies and is associated with different biological processes and diseases [PMC3281076]. It has been found to be unique to the platelet-micro-vesicle combined fraction and is not present in the platelet-derived fraction [PMC3281076]. Hsa-mir-1271 has also been shown to target ATGs16L, a gene involved in autophagy and implicated in inflammatory bowel disease susceptibility [PMC3281076]. In addition, hsa-mir-1271 has been linked to cancer cell resistance to cisplatin treatment [PMC8206191]. Silencing the expression of hsa-mir-1271 has been found to increase the level of CASP9, a gene involved in apoptosis, suggesting that hsa-mir-1271 may play a role in cell survival mechanisms [PMC8206191]. The expression of hsa-mir-1271 has also been shown to be altered in endometrial cell culture exposed to salinomycin, with increased expression observed at 12 and 48 hours but decreased expression at 24 hours [PMC8206191]. Hsa-mir-1271 has been identified as a potential diagnostic biomarker for malignant pleural mesothelioma (MPM) due to its association with carcinogenesis mechanisms and its upregulation in MPM compared to healthy controls [PMC4464514]. It is suggested that hsa-mir-1271, along with other miRNAs such as hsa-miR-96-5p and hsa-miR-409, may play a role in tumorigenesis and could serve as potential circulating biomarkers for MPM [PMC4464514].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUGCCUGCUAUGUGCCAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cavia porcellus cpo-miR-1271-3p
Publications