Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Phe secondary structure diagram

Homo sapiens (human) tRNA-Phe URS00001CE4E0_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bombyx mori tRNA Phe #AA
  2. Mus musculus tRNA Phe #AA
  3. Oryctolagus cuniculus (rabbit) tRNA-Phe
  4. Bos taurus P-site Phe-tRNA(Phe) from Bos taurus (PDB 7O7Y, chain AT)
  5. Xenopus laevis tRNA Phe #AA
2D structure