Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1294 URS00001C85C7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1294: Hsa-mir-1294 is a microRNA (miRNA) that has been studied in various contexts. In a study comparing epileptic children and controls, hsa-mir-1294 was found to have lower median TPM compared to hsa-miR-342-5p in discriminating epileptic children from healthy controls and drug-resistant epileptic children from drug-responsive epileptic children [PMC8866954]. Hsa-mir-1294 has also been implicated in the progression of oral squamous cell carcinoma [PMC8848895]. In another study, hsa-mir-1294 was predicted to target the genes ENO1 and circ-AMOTL1 [PMC7440838]. Additionally, hsa-mir-1294 was found to be involved in the regulation of several genes, including MAN2A2, TNFRSF12A, SPP1, CSNK1D, PLAUR, PFKFB3, and CXCL16 [PMC8836044]. Hsa-mir-1294 has also been associated with cognitive impairment progression [PMC9944228]. Furthermore, it has been identified as one of the potential miRNAs that interact with CXCL8 [PMC8923704]. Hsa-mir-1294 is one of the miRNAs with high expression log ratio in comparison to N-exo miRs in DMD-exo miRs [PMC7673361]. Lastly, it has been identified as one of the miRNAs associated with increased risk or decreased risk for certain conditions such as hepatocellular carcinoma and colorectal cancer [PMC8073146].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGAGGUUGGCAUUGUUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Callithrix jacchus cja-miR-1294
  2. Macaca fascicularis microRNA miR-1294-5p
  3. Pan troglodytes (chimpanzee) ptr-miR-1294
Publications