Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-2b precursor (dme-mir-2b-2) URS00001C80F0_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-miR-2b: dme-mir-2b is a member of the miR-2 family in Drosophila, and it shares the same mature sequence with dme-mir-2b-1 and dme-mir-2b-2, but is one nucleotide longer than the miRBase annotated sequences [PMC3268580]. The roles and functions of dme-mir-2b in Drosophila are not yet clear [PMC9100521]. Overexpression of dme-mir-2b, along with dme-mir-184 and dme-mir-274, resulted in almost total lethality during embryogenesis/development [PMC9100521]. Overexpression of dme-mir-2b specifically led to a similar outcome [PMC9100521]. Seven miRNAs, including dme-mir-2b, were found to be differentially expressed between long and short photoperiods [PMC9100521]. The overexpression of dme-mir-2b, along with other miRNAs, using UAS transgenes driven by Act-Gal4 or pdf-Gal4 resulted in changes in photoperiodic diapause [PMC9100521]. The microarray experiments indicated that both dme-mir-2b and dme-mir274 are expressed at higher levels in long days compared to short days [PMC9100521]. References: [PMC3268580] - Marco A. Mendoza-Mendoza et al. (2013) Evolutionary Conservation of microRNA Regulatory Circuits: An Examination of microRNA Gene Complexity and Clustering in Mammals, Fishes, Xenopus ,and Caenorhabditis elegans. PLoS ONE 8(6): e66415. [PMC9100521] - Hui Zhang et al. (2020) Identification and Functional Analysis of Differentially Expressed miRNAs in the Photoperiodic Diapause of the Onion Fly, Delia antiqua. Frontiers in Physiology 11: 573.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGUCAUUCUUCAAAGUGGUUGUGAAAUGUUUGCCUUUUUAUGCCUAUUCAUAUCACAGCCAGCUUUGAGGAGCGACGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications