Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-149-5p URS00001C770D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-149: Hsa-mir-149 is a microRNA that has been associated with increased or decreased risk of seven different types of cancer, including renal cell carcinoma, breast cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, papillary carcinoma, and thyroid cancer [PMC6594254]. In a study on osteoarthritis (OA), seven microRNAs were found to have statistically significant differential expression. Among these microRNAs, hsa-mir-149 was downregulated [PMC8966627]. MicroRNAs (miRNAs) are small non-coding RNA molecules that play important roles in gene regulation and have been implicated in various diseases including cancer. Hsa-mir-149 is one such miRNA that has been extensively studied in relation to its association with different types of cancers [PMC6594254]. The association between hsa-mir-149 polymorphisms and increased or decreased risk of various cancers suggests its potential role as a biomarker for these diseases. Understanding the functional significance of hsa-mir-149 in the development and progression of these cancers could provide valuable insights for diagnosis and treatment strategies [PMC6594254]. In the context of osteoarthritis (OA), the downregulation of hsa-mir-149 suggests its potential involvement in the pathogenesis of this disease. Further research is needed to elucidate the specific mechanisms by which hsa-mir-149 contributes to OA development and progression [PMC8966627]. Overall, hsa-mir-149 is a microRNA that has been associated with increased or decreased risk of multiple types of cancers. Its downregulation in osteoarthritis suggests its potential role in this disease as well. Further research is needed to fully understand the functional significance and mechanisms by which hsa-mir-149 contributes to these conditions [PMC6594254] [PMC8966627].

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCUCCGUGUCUUCACUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-149-5p
  2. Canis lupus familiaris cfa-miR-149
  3. Cavia porcellus cpo-miR-149-5p
  4. Cervus elaphus (red deer) cel-miR-149
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-149-5p
  6. Echinops telfairi Ete-Mir-149_5p (mature (guide))
  7. Eptesicus fuscus efu-miR-149
  8. Equus caballus eca-miR-149
  9. Gorilla gorilla gorilla ggo-miR-149 (MIR149)
  10. Gorilla gorilla (western gorilla) ggo-miR-149
  11. Macaca mulatta (Rhesus monkey) mml-miR-149-5p
  12. Mus musculus mmu-miR-149-5p
  13. Oryctolagus cuniculus Ocu-Mir-149_5p (mature (guide))
  14. Pan troglodytes (chimpanzee) ptr-miR-149
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-149
  16. Rattus norvegicus (Norway rat) rno-miR-149-5p
  17. Sus scrofa (pig) ssc-miR-149
Publications