Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-149-5p URS00001C770D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-149: Helicobacter pylori infection has been shown to silence mmu-mir-149, a microRNA, potentially promoting the pro-tumor properties of stromal fibroblasts and stimulating the production of IL-6 [PMC5576273]. This suggests that H. pylori infection may enhance the pro-tumor properties of stromal fibroblasts by targeting mmu-mir-149 and inducing IL-6 production [PMC4423088]. The targeting of mmu-mir-149 was confirmed by performing a method that verified its interaction with the 3'-UTR of IL-6 [PMC4423088]. Oligonucleotides for mmu-mir-149 mimics, inhibitors, and controls were obtained from GenePharma for further experimentation [PMC4423088]. Additionally, a CpG sites rich region was identified upstream of mmu-mir-149, which is conserved in humans [PMC4423088]. This region may play a role in regulating the expression of mmu-mir-149 [PMC4423088]. Furthermore, differential expression analysis was conducted using primers for various microRNAs including mmu-mir-149 in irradiated vs. control samples [PMC8349067].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCUCCGUGUCUUCACUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-149-5p
  2. Canis lupus familiaris cfa-miR-149
  3. Cavia porcellus cpo-miR-149-5p
  4. Cervus elaphus (red deer) cel-miR-149
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-149-5p
  6. Echinops telfairi Ete-Mir-149_5p (mature (guide))
  7. Eptesicus fuscus efu-miR-149
  8. Equus caballus eca-miR-149
  9. Gorilla gorilla gorilla ggo-miR-149 (MIR149)
  10. Gorilla gorilla (western gorilla) ggo-miR-149
  11. Homo sapiens hsa-miR-149-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-149-5p
  13. Oryctolagus cuniculus Ocu-Mir-149_5p (mature (guide))
  14. Pan troglodytes (chimpanzee) ptr-miR-149
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-149
  16. Rattus norvegicus (Norway rat) rno-miR-149-5p
  17. Sus scrofa (pig) ssc-miR-149
Publications