Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-432-5p URS00001C406A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-432: Hsa-mir-432 is a microRNA that has been studied in various contexts [PMC8449188]. In a study, it was found that hsa-mir-432 high-expression alone cells showed increased hsa-adar1 mRNA expression compared to hsa_circ_0000418 high-expression alone cells and hsa-mir-432 high-expression alone cells [PMC8449188]. In another study, it was observed that in hsa_circ_0000418 and hsa-mir-432 co-low cells, the expression of hsa-adar1 mRNA was significantly decreased [PMC8449188]. In the context of schizophrenia, a seven-miRNA signature including hsa-mir-432 was identified in mononuclear leukocytes and found to be correlated with negative symptoms, neurocognitive performance scores, and event-related potentials in patients [PMC3726785]. Furthermore, a screening of significantly differentially expressed miRNAs identified hsa-mir-432 as one of the top ten miRNAs based on P-values [PMC5759858]. However, another study showed that the expression levels of both hsa-miR-34a and hsa-mir-432 were not changed following treatment [PMC9881575]. Additionally, it has been reported that human breast milk contains various miRNAs including hsa-miR-136, hsa-miR-135a, and also includes colostrum-specific miRNAs such as hsa-mir-432 [PMC8787201].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGGAGUAGGUCAUUGGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus bta-miR-432
  2. Callithrix jacchus cja-miR-432
  3. Canis lupus familiaris cfa-miR-432
  4. Capra hircus chi-miR-432-5p
  5. Cavia porcellus cpo-miR-432-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-432-5p
  7. Equus caballus eca-miR-432
  8. Macaca mulatta (Rhesus monkey) mml-miR-432-5p
  9. Oryctolagus cuniculus ocu-miR-432-5p
  10. Ovis aries oar-miR-432
  11. Pan troglodytes (chimpanzee) ptr-miR-432
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-432
Publications