Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-99b-3p URS00001C308D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-99b: Mmu-mir-99b is an up-regulated miRNA that has been identified in several studies [PMC4989891]. It has been found to be in the linear range of the RT-qPCR at a concentration of 2.5 ng RNA [PMC4077261]. Mmu-mir-99b is one of the miRNAs that were used in Applied Biosystems TaqMan® miRNA assays [PMC4077261]. It has been observed that mmu-mir-99b potentially regulates Hmgcs2, a gene encoding an enzyme involved in hydroxymethylglutaryl-CoA synthesis [PMC3692539]. Mmu-mir-99b is highly abundant and has been sequenced on average 20,000 times [PMC3477035]. It has also been found to be differentially expressed during dermal wound healing in mice [PMC3665798]. In silico analysis revealed that mmu-mir-99b may target the 3'UTR of MFG-E8 gene [PMC4990839]. MiRNA-Seq analysis showed that mmu-mir-99b is regulated by Esrrb, a transcription factor involved in gene regulation [PMC9149258]. However, mmu-mir-99b has less weight in Esrrb miRNA regulation as it regulates less than 10 target genes compared to other miRNAs like mmu-mir-688 and mmu-mir-711 [PMC9149258].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUCGUGUCUGUGGGUCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cavia porcellus cpo-miR-99b-3p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-99b
  3. Homo sapiens (human) hsa-miR-99b-3p
  4. Rattus norvegicus (Norway rat) rno-miR-99b-3p
Publications