Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-99b-3p URS00001C308D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-99b: Hsa-mir-99b is part of a highly conserved cluster that regulates the number of hematopoietic stem cells, which can give rise to myeloid cells for defense against viral infection [PMC3836776]. In a study, the expression levels of various microRNAs were analyzed, and it was found that hsa-miR-21-5p and hsa-miR-7a-5p were present in high copy numbers, with average Ct values of 27.82 and 28.98, respectively [PMC6090775]. Conversely, hsa-mir-99b, hsa-miR-141-3p, and hsa-miR-145 had lower expression levels with average Ct values of 32.50, 34.72, and 32.46, respectively [PMC6090775].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUCGUGUCUGUGGGUCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cavia porcellus cpo-miR-99b-3p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-99b
  3. Mus musculus (house mouse) mmu-miR-99b-3p
  4. Rattus norvegicus (Norway rat) rno-miR-99b-3p
Publications