Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-34c-3p URS00001C29D5_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-34c: Mmu-mir-34c is an interacting microRNA that has been identified as a potential biomarker in vascular aging [PMC6781998]. It is one of the microRNAs that were found to be common between networks built by turquoise and blue modules [PMC6781998]. Transcriptional alterations of hub genes Enpp5, Fez1, Kif1a, and F3 were confirmed using RT-PCR, along with the interacting microRNAs mmu-mir-34c, mmu-miR-34b-5p, mmu-let-7, mmu-miR-449a, and mmu-miR-449c [PMC6781998]. These findings suggest that mmu-mir-34c may play a role in vascular aging and could potentially serve as a biomarker for this process. Further research is needed to fully understand the mechanisms by which this microRNA influences vascular aging and to validate its potential as a biomarker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCACUAACCACACAGCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gallus gallus gga-miR-34c-3p
  2. Rattus norvegicus (Norway rat) rno-miR-34c-3p
Publications