Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 81 (SNORA81) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 81 (SNORA81) URS00001C12A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA81: SNORA81 is a small nucleolar RNA (snoRNA) that has been studied in various contexts. In one study, a SYBR green approach was used to measure the relative mRNA levels of snoRNAs, including SNORA81, in different cell lines [PMC7760958]. Knockdown of SNORA81 was found to reduce the modification in position 4606 of the 28S rRNA and decrease the amount of 28S rRNA, leading to changes in the ratio of 28S/18S rRNA [PMC8759569]. Another study identified SNORA81 as one of the top upregulated genes upon infection [PMC7308782]. The combination of SNORA81 with other snoRNAs (SNORD72, SNORA56, and SNORA19) showed high sensitivity and specificity values [PMC8759569]. Knockdown experiments revealed that both SNORA19 and SNORA81 could affect cell growth and invasiveness through changes in rRNA biogenesis [PMC8759569]. The impact of knocking down these snoRNAs on migration, wound healing, and invasion was also examined [PMC8759569]. These findings suggest that SNORA81 plays a role in various cellular processes and may have implications for cancer cell aggressiveness.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUCUUGUAUAAGCACUGUGCUAAAAUUGCAGACACUAGGACCAUGUCUUGGUUUUUGCAAUAAUGCUUGCAGAGUACACACAAGAAGAAAAGUAACAGCACUAGAUUGUAAAGACUGGGGUGGACCUCUUUCUUAAUGUCCAAUGUCCUUUGUCUUAAGAUUUGGUGCAAUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications