Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-488-3p URS00001BCAC5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-488: Hsa-mir-488 is highly expressed in various regions of the nervous system, including the amygdala, temporal lobe, globus pallidus, cerebellum peduncles, cerebellum, caudate nucleus, whole brain, parietal lobe, medulla oblongata, prefrontal cortex, occipital lobe, hypothalamus, thalamus, subthalamic nucleus, cingulated cortex, pons, and spinal cord [PMC2635472]. It is also expressed in the fetal brain and in non-neuronal tissues such as the adrenal gland and adrenal cortex [PMC2635472]. Hsa-mir-488 has been found to have binding sites in a circular RNA called hsa_circ_0001649 for several other microRNAs including hsa-miR-203a and hsa-miR-127 [PMC7497355]. In various studies on different diseases and conditions such as schizophrenia and hepatocellular carcinoma (HCC), hsa-mir-488 has been found to be differentially expressed [PMC4863087][PMC7271455][PMC2707367][PMC6921333][PMC4046763]. It has also been shown to interact with viral genomes such as HCV RNA [PMC5511817]. Additionally, the human CYP1A1 gene has been found to have binding sites for hsa-mir-488 in its 3'UTR region [PMC5220472]. In liver cells with HBx expression (a viral protein), hsa-mir-488 was found to be upregulated [PMC5352919].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAAAGGCUAUUUCUUGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callithrix jacchus cja-miR-488
  2. Canis lupus familiaris Cfa-Mir-488_3p (mature (guide))
  3. Dasypus novemcinctus dno-miR-488-3p
  4. Equus caballus (horse) eca-miR-488
  5. Macaca mulatta mml-miR-488-3p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-48795663
  7. Oryctolagus cuniculus ocu-miR-488-3p
  8. Pan troglodytes (chimpanzee) ptr-miR-488
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-488
Publications