Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-429-5p URS00001BB658_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-429: The most differentially expressed miRNA was mmu-mir-429, a member of the miR-200 family, and 4 of the 5 miR-200f members (miR-141, miR-200b, miR-200c and miR-429) were in the top 15 differentially expressed miRNAs [PMC5410340]. Mmu-mir-429 was selected for further study based on its high Context Score [PMC4430899]. Analysis using IPA identified enrichment of the 'Phospholipase C Signaling' pathway for mmu-mir-429 [PMC5220332]. In an experimental colitis group, mmu-mir-429 was found to be low expressed compared to the control group [PMC8648272]. Mmu-mir-429 was one of the 9 miRNAs that showed differential expression between WT and Pkd1-/- genotypes at different developmental stages [PMC3111376]. Mmu-mir-429 has been observed to have decreased expression in nucleus accumbens neurons after sciatic nerve ligation in mice, along with mmu-miR-200b [PMC8914318]. The expression of DNA methyltransferase 3 alpha (Dnmt3a), a target of mmu-miR-200b and mmu-mir-429, was increased in nucleus accumbens [PMC8914318]. The sequences for qPCR primers specific to mmu-mir-429 are not provided in the study [PMC5122366].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCUUACCAGACAUGGUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications