Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-15a URS00001BACF3_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-15a: Gga-mir-15a is a microRNA that targets key genes such as B-cell leukemia/lymphoma 2 to regulate tumor growth [PMC3281030]. It has been found to specifically target FOXO1A and KPNA3 [PMC3281030]. Gga-mir-15a and gga-miR-16-1 can bind to the mRNAs of FOXO1A and KPNA3 [PMC3281030]. These microRNA genes are located in close proximity to significant SNPs in the 1.5 Mb region of KPNA3-FOXO1A [PMC3281030]. Gga-mir-15a has been shown to have a conserved binding site with chicken IGF1 [PMC3281030]. It has also been found to target tyrosine-protein kinase receptor (CTK-1) along with gga-miR-15c-5p and gga-miR-16-5p [PMC5364632]. The relative expression of gga-mir-15a is significantly higher in the HFCR group compared to the MFCR and LFCR groups [PMC5586008]. Gga-mir-15a has been identified as a promising candidate gene for feed efficiency based on its interactions with target genes involved in the insulin-signaling pathway [PMC5586008]. Bioinformatics analysis has predicted numerous target genes for gga-mir-15a, including FOXO1, which is considered its most reliable target gene among 12 targets identified [PMC5586008, PMC7936154]. Gga-mir-15a expression is significantly lower in chickens with lower feed conversion ratios [PMC7936154].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUAAUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus bta-miR-15a
  2. Canis lupus familiaris cfa-miR-15a
  3. Chiloscyllium plagiosum microRNA cpl-miR-15a
  4. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72434
  5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-15a
  6. Ornithorhynchus anatinus (platypus) oan-miR-15a-5p
  7. Otolemur garnettii oga-miR-15a
  8. Pteropus alecto (black flying fox) pal-miR-15a-5p
  9. Sus scrofa (pig) ssc-miR-15a
  10. Taeniopygia guttata tgu-miR-15a-5p
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1551775
Publications