Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-27a-5p URS00001B341F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-27a: Mmu-mir-27a is a proinflammatory gene that has been implicated in various biological processes. In macrophages, it has been shown that mmu-mir-27a can decrease the secretion of proinflammatory cytokines, such as IL-6, IL-1β, and IL-10, when stimulated by LPS [PMC5937725]. In a study on myocardial ischemia-reperfusion injury in mice, it was found that the inhibition of mmu-mir-27a can activate the NF-κB pathway and provide protection against injury [PMC7238603]. Mmu-mir-27a has also been implicated in diabetic peripheral neuropathy development and peripheral neuropathy in diabetic mice [PMC8914318]. Furthermore, mmu-mir-27a has been found to be downregulated in various conditions such as leukemia and oocyte maturation [PMC3919606] [PMC4069098]. It has also been shown to target genes such as Acads and Serpini1 [PMC3692539] [PMC4805586]. Additionally, mmu-mir-27a is involved in liver regeneration and the regulation of the renin-angiotensin system in fetal offspring exposed to a low protein diet during pregnancy [PMC9198802] [PMC5496128]. The regulation of mmu-mir-27a is complex and involves interactions with other miRNAs and transcription factors such as Smad members, Stat3, Men1, and Kmt2a [PMC7906897]. Overall, mmu-mir-27a plays a significant role in various biological processes and its dysregulation can have implications for disease development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCUUAGCUGCUUGUGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-27a-5p
  2. Capra hircus chi-miR-27a-5p
  3. Cavia porcellus cpo-miR-27a-5p
  4. Cervus elaphus cel-miR-27a-5p
  5. Cricetulus griseus cgr-miR-27a-5p
  6. Dasypus novemcinctus dno-miR-27a-5p
  7. Homo sapiens hsa-miR-27a-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-27a-5p
  9. Pteropus alecto (black flying fox) pal-miR-27a-5p
  10. Rattus norvegicus (Norway rat) rno-miR-27a-5p
Publications