v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1398 (LINC01398) URS00001B0AEF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01398: LINC01398 is a long intergenic non-protein coding RNA (lncRNA) that is negatively correlated with resting dendritic cell and M2 macrophage infiltration [PMC8187926]. In a study, it was found that DPP10-AS3 was positively correlated with resting dendritic cell, neutrophil, and γδ T cell infiltration, while LINC01398 was negatively correlated with resting dendritic cell and M2 macrophage infiltration [PMC8187926]. Among 11 immune-related lncRNAs analyzed, ARHGAP26-AS1, FUT8-AS1, FOXCUT, and C5orf64 were highly expressed in the high-risk group, while NAV2-AS2, LINC00408, SEC24B-AS1, LINC01343, LINC01398 (LINC), LINC01197 and DPP10-AS3 were lowly expressed in the high-risk group [PMC8187926]. Additionally, DPP10-AS3 was found to be negatively correlated with resting dendritic cell infiltration as well as neutrophil and γδ T cell infiltration [PMC8187926]. In another study investigating lncRNAs in different cohorts of patients with cancerous tumors it was found that few lncRNAs were identified in the training cohort (KIFC1 and DSCR4) as well as in the validation cohort (SLC44A4 , PSMB1 , LINC01398 , LINC01213 , LINC00851) [PMC9808058]. However CRNDE was significantly correlated in both cohorts [PMC9808058].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUGGGAGGCCCAUAUCUGGGCUCACCAGCCCUGCCAUCUUUGUCACAGCCUCUGUCCAGGCCAAUGUGUCCUCCAGCUCAGCUUACUCCUUCAUUCAUUUUUUCAGGAAACAUUCAAGGACCUUCUUCCAAGGGCACAAUACUGAGCAACAUGGACAAGGUCUGGCCCUAUGGUAAAGUCAGGUCUGGAUCAUGGAAUUGAAUGGGGUGUGUUGCCAGGCACCCGCAUGAGGGGCUGGCUCCUCCCCGUGAAUUCUGGGCACAGACACCCAGACCUGAGCAGGCCCCUCACCCCACAGCGACUGGGGAGCCGGAGCCCGAGUCCCUCCCACCUGCUCCCUCGGUUUCUGAGGGUCUGUCUCAUCCUGCAGCUGGACAGACGUGAUCUUCAGCCCCAAGUUACAGACGCUUAGAGAAGCUGGAGACUUGCACAAUGUCUCAGAGGAAAGAGAGCCAGAACCUGGACCCGUGUUGUACCCCAACCAAACCCUCCAUGGUGGAAGGAAUAGGAGUGGGAAGGGGAGGAGGAGACAUAUGGUCCAGGAGGUUCCAUAUGUACCCACACAUGGACCUCAAAGAGGCCCCCACAGCAAGACAGCAAAUGACAUCCACAGUCACAGAUCACGGAGUGAUUUCAGAUGAAGAUGGUGCUGGCAGUUUCCCCAUCAGCGCAAUGGAGUUUGAGCAAAGGAUCUCACUGGAGAAGUCGCAGCGACAGUGGAUCUAAGAGCAGAGGGCAAGGGCUGCCUGAGCCUUGUGAAGCUCAAUUCUGCCCCCUGGUGCCCAGAAUGCCGCGCCAGCAAUGGGAUGCAGGAAGAAGAGGCAGGAGACACCUGAGGUCUCUUACCUUUUCCAAGCUACUCAGACCUCCCUCUUACAGGGCAGGGAACACAGGGCACCAGCCCUACUAACCCAAUCUGAGGGGAAACUCUGAGGCUCCCUCUCCUGCAGAGAUCUCAGACUCUGUGGUAGAGUUGGUGUGGGGGGACACGUGACGUCAGCAAUAGCCCUGUCCAUCCAGCACCUGGACACCCCGAGUGGUUCCUUCUAUGGGAGGCAGAGGCAGGGCUGCCCCCUCUGCUGUGCAAUUCCUGGGGUCUUCAUCUGAGUUAAAUUCUUUUAAGUCAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications