v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-212-5p URS00001AFC71_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-212: Hsa-mir-212 is a mature microRNA with the sequence UAACAGUCUCCAGUCACGGCC [ABI/Life Technologies; 4427975] [1]. It has been shown to have a negative regulatory function on the expression of INTU and IFT88 [PMC9596204] [2]. Additionally, hsa-mir-212 has been found to downregulate the expression of RBP2 in hepatocellular carcinoma cells [PMC4665154] [3]. These findings suggest that hsa-mir-212 plays a role in regulating gene expression and may have implications in cancer research [3]. References: [1] ABI/Life Technologies; 4427975 [2] PMC9596204 [3] PMC4665154

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCUUGGCUCUAGACUGCUUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis Ami-Mir-132-P2_5p (mature (co-guide))
  2. Anolis carolinensis (green anole) Aca-Mir-132-P2_5p (mature (guide))
  3. Bos taurus (cattle) bta-miR-212
  4. Canis lupus familiaris cfa-miR-212
  5. Cavia porcellus (domestic guinea pig) cpo-miR-212-5p
  6. Cricetulus griseus cgr-miR-212
  7. Danio rerio dre-miR-212-5p
  8. Gallus gallus (chicken) gga-miR-212-5p
  9. Gekko japonicus Gja-Mir-132-P2_5p (mature (co-guide))
  10. Ictalurus punctatus ipu-miR-212
  11. Latimeria chalumnae Lch-Mir-132-P2_5p (mature (co-guide))
  12. Lepisosteus oculatus (spotted gar) Loc-Mir-132-P2_5p (mature (guide))
  13. Macaca mulatta (Rhesus monkey) mml-miR-212-5p
  14. Microcaecilia unicolor Mun-Mir-132-P2_5p (mature (co-guide))
  15. Monodelphis domestica (gray short-tailed opossum) mdo-miR-212-5p
  16. Mus musculus (house mouse) mmu-miR-212-5p
  17. Neolamprologus brichardi (lyretail cichlid) nbr-miR-212b
  18. Oryctolagus cuniculus ocu-miR-212-5p
  19. Pteropus alecto pal-miR-212-5p
  20. Python bivittatus pbv-miR-212-5p
  21. Rattus norvegicus (Norway rat) Rno-Mir-132-P2_5p (mature (co-guide))
  22. Salmo salar ssa-miR-212b-5p
  23. Sarcophilus harrisii Sha-Mir-132-P2_5p (mature (co-guide))
  24. Sphenodon punctatus Spt-Mir-132-P2_5p (mature (co-guide))
  25. Sus scrofa (pig) ssc-miR-212
  26. Taeniopygia guttata (zebra finch) Tgu-Mir-132-P2_5p (mature (guide))
  27. Tetraodon nigroviridis Tni-Mir-132-P2a_5p (mature (co-guide))
  28. Xenopus laevis Xla-Mir-132-P2c_5p (mature (guide))
  29. Xenopus tropicalis Xtr-Mir-132-P2_5p (mature (co-guide))
 Publications