Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR397a-5p URS00001A980F_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR397a-5p: Zma-mir397a-5p is a microRNA that is up-regulated in certain conditions [PMC6769569]. In a study, several up-regulated long non-coding RNAs (lncRNAs) were predicted to be the target mimics of zma-mir397a-5p, along with zma-miR395b-5p and zma-miR395h-5p [PMC6769569]. These lncRNAs, including TCONS_00113799, TCONS_00165850, and TCONS_00153885, were found to be potential target mimics of zma-mir397a-5p [PMC6769569]. Previous research has suggested that zma-mir397a-5p, along with other members of the miR399 and miR397 families (zma-miR395b-5p and zma-miR395h-5p), may play a role in controlling fatty acid metabolism and promoting lipid delivery from plants to AM fungi [PMC6769569]. In another study, zma-mir397a-5p was identified as one of the differential miRNAs along with other miRNAs such as zma-miR164b-3p and zma-miR156k-5p [PMC5963143]. It was suggested that genes involved in fatty acid metabolism could be regulated by zma-mir397a-5p, along with other miRNAs like zma-miR399b-5p and zma-miR399h-5p [PMC6214007].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUUGAGCGCAGCGUUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cynara cardunculus var. scolymus cca-miR397e
Publications