Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Gln (CAA/G) (MT-TQ) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Gln (CAA/G) (MT-TQ) URS000019B78E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TQ: Because of the positioning of genes, the termination of LSP and HSP1 at a point between mt.3229 (the end of the 16S ribosomal RNA as transcribed by HSP1) and mt.4329 (the end of MT-TQ as transcribed by LSP) would allow the simultaneous utilization of LSP and HSP1 without promoter collision [1]. Moreover, numerous mitochondrial DNA (mtDNA) encoded genes have other rare variants that can cause MELAS; these include mtDNA encoded tRNAs (MT-TS1, MT-TS2, MT-TW, MT-TC, MT-TL2, MT-TK, MT-TH, MT-TQ, MT-TF, and MT-TV) and mitochondrial respiratory chain (MRC) complex I (MT-ND1, MT-ND5, and MT-ND6), complex III (MT-CYB), and complex IV (CIV) subunits (MT-CO2 and MT-CO3) [2]. 1A); mitochondrial tRNA gene MT-TQ was highest ranked among tissue:challenge DEGs (edgeR FDR = 1.3 × 10−4) [3]. References: [1] PMC6961661 [2] PMC8153374 [3] PMC5453329

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGAUGGGGUGUGAUAGGUGGCACGGAGAAUUUUGGAUUCUCAGGGAUGGGUUCGAUUCUCAUAGUCCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Cloning vector pRS316-1B9 tRNA-Gln
  2. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Gln
  3. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Gln
  4. Pan troglodytes tRNA-OTHER
  5. Pan troglodytes schweinfurthii tRNA-Gln
2D structure Publications