Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3153 URS0000192A75_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3153: Hsa-mir-3153 is a down-regulated miRNA in EGFR-TKI primary resistance patients, as identified in a study [PMC5687624]. This study also found that 15 other miRNAs were down-regulated, while only hsa-miR-503-3p was up-regulated in these patients [PMC5687624]. Another study found that the mature miRNA sequence of hsa-mir-3153 can target the MSX2 mRNA [PMC9030878]. Additionally, this study revealed that LINC02701 can target GFAP expression via hsa-mir-3153 [PMC9030878]. The targeting relationship between hsa-mir-3153 and GFAP was predicted using multiple analysis methods [PMC9030878]. Furthermore, a network analysis identified 5 lncRNAs, 5 miRNAs (including hsa-mir-3153), and 12 mRNAs as hub RNAs in triple regulatory networks [PMC9030878]. In the context of testicular germ cell tumors (TGCT), miR371 was found to have a sensitive diagnostic specificity [PMC9030878]. Finally, bioinformatics prediction tools were used to identify potential regulators of C2CD4A, including hsa-mir-3153 [PMC8520208].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGAAAGCGAGUAGGGACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications