Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Cys (UGU/C) (MT-TC) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Cys (UGU/C) (MT-TC) URS000018E119_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TC: To date, there are only a limited number of reports on mitochondrially encoded tRNACys (MT-TC) [1]. In a study investigating UCB recurrence, PTGDR, KLRF1, and MT-TC genes were found to be downregulated in new positive samples compared to negative and recurrent samples [2]. Conversely, RNU6-135P was upregulated in new positive samples compared to previously positive and recurrent samples [2]. The MT-CO3, MT-TA, MT-TC, and MT-TT region was identified as potentially containing pathogenic alleles [3]. Variants were observed in various mitochondrial tRNA genes including two in MT-TL1 and MT-TL2 respectively and one in MT-TC, MT-TF, and MT-TY respectively [4]. Specifically focusing on the gene encoding tRNA-Cys (MT-TC), various single-nucleotide substitutions have been associated with myopathy or hearing loss [5]. References: 1. PMC8907771 2. PMC6962349 3. PMC6034246 4. PMC7707901 5. PMC9276701

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUCCGAGGUGAUUUUCAUAUUGAAUUGCAAAUUCGAAGAAGCAGCUUCAAACCUGCCGGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cloning vector pRS316-1B9 tRNA-Cys
2D structure Publications