Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-181c-5p URS000018C928_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-181c: Mmu-mir-181c is a pri-miRNA that has been studied in various contexts. It has been used as a target in experiments involving RNA-probes and miRNA mimics. In one study, digoxigenin-labeled RNA-probes were generated against mmu-mir-181c, along with other pri-miRNAs, and used for further analysis [PMC7904729]. In another study, miRNA mimics for mmu-mir-181c were transfected into mESCs or embryoid bodies [PMC2933889]. Mmu-mir-181c has also been found to be involved in lymphoid development and differentially expressed between lymphocyte cell types [PMC2244641]. Additionally, it has been identified as one of the up-regulated miRNAs in a specific context [PMC4989891]. Mmu-mir-181c has also shown significant correlation with mRNA transcripts in the liver gene regulatory network [PMC3130556]. Furthermore, it was found to be regulated along with other miRNAs at the gene expression level [PMC5207734]. These studies highlight the importance of mmu-mir-181c in various biological processes and provide insights into its regulatory role.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Daubentonia madagascariensis dma-miR-181c
  4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  5. Gorilla gorilla ggo-miR-181c
  6. Homo sapiens (human) hsa-miR-181c-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-181c-5p
  8. Pan paniscus ppa-miR-181c
  9. Pan troglodytes ptr-miR-181c
  10. Pongo pygmaeus ppy-miR-181c
  11. Rattus norvegicus (Norway rat) rno-miR-181c-5p
  12. Sus scrofa (pig) ssc-miR-181c
  13. Tupaia chinensis tch-miR-181c-5p
Publications