Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-140-P1-v2_3p (mature (guide)) URS000018A236_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-140: Hsa-mir-140, a microRNA known for its impairment of tumor growth [PMC5511817], may serve as a host cell's last line of defense against viruses, along with hsa-miR-199a [PMC5511817]. In human pulmonary fibrotic tissues from patients with idiopathic pulmonary fibrosis (IPF), the upregulation of the long non-coding RNA H19 contributes to fibrosis through the TGFB/SMAD3 signaling pathway [PMC7279016]. Hsa-mir-140 is involved in this process by sequestering H19 [PMC7279016].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCACAGGGUAGAACCACGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-140-P1-v2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-140-P1-v2_3p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-140-P1-v2_3p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-140-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-140-P1-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-140-P1-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-140-P1-v2_3p (mature (guide))
  8. Columba livia Cli-Mir-140-P1-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) dre-miR-140-3p
  10. Dasypus novemcinctus Dno-Mir-140-P1-v2_3p (mature (guide))
  11. Echinops telfairi Ete-Mir-140-P1-v2_3p (mature (guide))
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-140-P3-v2_3p (mature (guide))
  13. Gadus morhua Gmo-Mir-140-P1-v2_3p (mature (guide))
  14. Gallus gallus Gga-Mir-140-P1-v2_3p (mature (guide))
  15. Gekko japonicus Gja-Mir-140-P1-v2_3p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-140-P1-v2_3p (mature (guide))
  17. Macaca mulatta (Rhesus monkey) Mml-Mir-140-P1-v2_3p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-140-P1-v2_3p (mature (guide))
  19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-140-P1-v2_3p (mature (guide))
  20. Monopterus albus Mal-Mir-140-P1-v2_3p (mature (guide))
  21. Mus musculus (house mouse) Mmu-Mir-140-P1-v2_3p (mature (guide))
  22. Ophiophagus hannah oha-miR-140-3p
  23. Ornithorhynchus anatinus (platypus) Oan-Mir-140-P1-v2_3p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-140-P1-v2_3p (mature (guide))
  25. Rattus norvegicus (Norway rat) Rno-Mir-140-P1-v2_3p (mature (guide))
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-140-P1-v2_3p (mature (guide))
  27. Scyliorhinus torazame Sto-Mir-140-P1-v2_3p (mature (guide))
  28. Sus scrofa (pig) ssc-miR-140-3p
  29. Taeniopygia guttata (zebra finch) tgu-miR-140-3p
  30. Tetraodon nigroviridis Tni-Mir-140-P1-v2_3p (mature (guide))
  31. Tor tambroides miR-140-3p
  32. Xenopus laevis xla-miR-140-3p
  33. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-140-P1-v2_3p (mature (guide))
Publications