Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 41 (SNORD41) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 41 (SNORD41) URS0000185C0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD41: SNORD41 is a C/D-box small nucleolar RNA (snoRNA) that belongs to a class of regulatory RNAs responsible for ribosomal RNA precursor editing [PMC8038546]. It has been observed that the expression levels of SNORD41 remain similar in tumor samples (19T), matched normal samples (19N), and stroma samples (19S) [PMC8038546]. SNORD41, along with other snoRNAs such as SNORA21, SNORA56, SNORD12B, SNORD12C, and SNORD15A, has been found to play an important role in cancer development [PMC7072173]. In a study on Fib-depletion, it was found that the levels of snoRNAs such as 28S-Am1858 (snoRD38A/B), 28S-Am3703 (snoRD36C), and 28S-Um4276 (SNORD41) were decreased [PMC8677024]. Additionally, in another study on gene expression analysis, it was observed that SNORD41 was one of the most significantly negatively regulated differentially expressed genes [PMC8506768]. In yeast studies involving the dbr1Δ mutant strain and transformation with SNORD41 constructs, it was found that U2-C41 was modified by both independently transcribed and intronic chimeric guide RNAs derived from SNORD41 [PMC8609340]. Furthermore, it has been reported that SNORD41 is located on chromosome 19 along with other snoRNAs such as SNORA68 and SNOR105 [PMC3511933]. Finally, in another study on breast cancer samples, it was found that SNORD41, SNORD83A, and SNORA73B were upregulated, while SNORD59A, SNORD111B, and SNORD119 were downregulated [PMC9803687].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAAGUGAUGACACCUGUGACUGUUGAUGUGGAACUGAUUUAUCGCGUAUUCGUACUGGCUGAUCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications