Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-224 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-224 precursor URS0000184017_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR224: MIR224 is a microRNA that has been implicated in various biological processes and diseases. It has been shown to be up-regulated in siAQP4 treated animals, leading to a reduction in Cx43 expression [PMC5843607]. Estradiol (E2) is known to play a crucial role in the regulation of MIR224, and it has been identified as a key regulator of MIR224 in both esophageal adenocarcinoma (EA) and esophageal squamous cell carcinoma (ESCC) [PMC6609598]. In addition, MIR224 has been identified as a potential biomarker for EA [PMC6609598]. Aberrant expression of miRNAs, including MIR224, has also been observed in autoimmune diseases such as lupus erythematosus [PMC5351619]. MIR224 is one of the miRNAs involved in the progression of pancreatic adenocarcinoma (PAAD) [PMC6005310]. It also plays a critical role in chemoresistance in ovarian cancer cells by regulating the PRKCD pathway [PMC8071157]. Furthermore, MIR224 targets glycine methyltransferases and is involved in epithelial-mesenchymal transition (EMT) regulation in colorectal cancer [PMC9775527] [PMC5240405]. It has also been implicated as a prognostic candidate for colorectal cancer [PMC5935085]. Additionally, MIR224 is overexpressed in WNT medulloblastomas and promotes migration of hepatocellular carcinoma (HCC) and colorectal cancer (CRC) by binding to Smad4 and HOXD10 proteins [PMC4333163] [PMC5226496]. Furthermore, it regulates NCR1 expression levels and plays a role in post-stroke angiogenesis processes along with other miRNAs such as miR225, miR335, and miR139-5p [PMC9166526] [PMC6732937].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

2D structure Publications