Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) WNT5A antisense RNA 1 URS000018347E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

WNT5A-AS1: WNT5A-AS1 is a long non-coding RNA (lncRNA) that has been identified as significantly associated with immune genes among ER-lncRNAs [PMC9843421]. However, there is a lack of literature and research on the biological properties and functions of WNT5A-AS1 in tumors [PMC9843421]. Along with other lncRNAs, such as LINC00871, MIR205HG, GATA2-AS1, ZNF436-AS1, SChLPA1, LINC01341, DNAJC9-AS1, VIPR1-AS1, AC108676.1, LINC01579, and RBM26-AS1 [PMC9843421], WNT5A-AS1 has been found to be differentially linked with immune-related genes such as CCR5, CCR4, IL-4, and IL-10 [PMC9843421]. WNT5A-AS1 is one of the three ERIR-lncRNAs (LINC00871 and SChLPA) that have been associated with prognosis in patients [PMC9843421]. Additionally, WNT5A-AS has been identified as a risk lncRNA in an immune-related prognostic signature along with AL136084.3 [PMC7343518]. Patients with high expression of WNT5A-AS have been found to have a poor survival time based on univariate Cox hazard ratio analysis [PMC7343518].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUUUGGGGCCACAGAACAAUCAGGCGCGCAUGGCUUUUUCUCCGGGAGAUGCCGCUGAAAACGCACAAGUCGCCAUCUGAGCUGCAAGAGUCAGCCCCAAAUUGUGUCCUUUCAUUUUAGGGUUCGGCAAAAACGGGGAGCAAAAUAGGUGAAAGUCGCCCCGGAACUUAUUGCUGUGCGGGCGAAGGGCGAAGAGCAGCGAGUGCACCGCGGGCGCGAGGCUGGGGAAGGGCGAGAGCUCGGAGCUCCGCGGCGGCGACUCAGCUCCGGCGGUCCAUGGCCGGCGAAGCUGCCCACCUCCUCGUUUGGCGCCCGGGUCCGAGGGGCGGGAGAGCGGGCCGGCGGGAGGCGGGCGGUCCCGGGCACAACGGCGGCGGCGGAAGGGCUCGCUGGGCAGCUGCCGCACGGACCCCGGCUCUGGGCGGCGGAGGCGGCUCCGUGGAGCUCGCAGCAGAUUUCCACGCGAUCCUGUGCCCCGCAAACAGACUGACCGACCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications