Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZBTB40 intronic transcript 1 (ZBTB40-IT1) URS0000174377_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZBTB40-IT1: ZBTB40-IT1 is a long non-coding RNA (lncRNA) that has been reported to regulate the biological behavior and serve as a prognostic tumor biomarker in various cancer types [57][PMC8855154]. It is included in the prognostic signatures for both progression-free survival (PFS) and overall survival (OS) in cancer patients [57][PMC8855154]. In addition to its role in cancer, ZBTB40-IT1 has been found to regulate bone metabolism by suppressing osteogenesis and promoting osteoclastogenesis [57][PMC7698531]. It modulates the expression of genes involved in bone formation, such as WNT4, RUNX2, Osterix (OSX), ALP, COL1A1, OPG, and RANKL [57][PMC7698531]. ZBTB40-IT1 has also been found to have a correlation with ATM and ASH1L, which are involved in immune response and inflammation modulation [57][PMC6854775]. Furthermore, ZBTB40-IT1 exerts an adverse effect on osteogenic differentiation by modulating WNT4 expression [57][PMC9150698]. In a study on breast cancer patients, ZBTB40-IT1 was identified as one of the m6A-related prognostic lncRNAs associated with breast cancer susceptibility gene BRCA [57][PMC8554333].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACUGUGGAUCUCAAGCCCUCAGUGCCAGCCUGGCACUGGGAAAGCGUGUCAAUUGCAGCAGAGGUGUCAAUCCAUCAGACCCAAGCUCCAUUCAGUGCAUUCCCCUUACCUGUUCCGCUGCAAAACCCAGAGUCCCUCAUUCCUAGUUCAGGAAGAAUCUCAUUUUAAGUGGGGAGAAAGGAAGCAUCCCUCCACUUGUGCUGUUGAUGACAAAGGAAUUAGUGAUGCUCUGGGGAGUGUGCUGGAAAUCCUCUACAGAGAAUUAGAAAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications