Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-1) URS0000173F7B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR219A1: MIR219A1 is a microRNA that is downregulated in the brain of Alzheimer's disease (AD) patients [PMC7564652]. In the cortex of AD patients, MIR219A1 is also found to be downregulated [PMC7564652]. MIR219A1, along with other miRNAs such as MIR29B1, MIR129-2, MIR199A2, MIR92A1, and MIR1296, has been observed to be dysregulated in AD patients [PMC7564652]. Specifically, in AD patients, MIR219A1 targets Tau and its phosphorylation [PMC7564652]. In addition to its role in AD pathology, the microRNA gene MIR219A1 has been associated with significant associations with other loci in genome-wide association studies (GWAS) [PMC4895015]. Furthermore, the expression of MIR219A1 has been found to be altered in various contexts such as pre-miRNAs and miRNAs associated with specific pathways [PMC5538553]. Overall, these findings highlight the importance of understanding the role of microRNAs like MIR219A1 in AD pathology and their potential as therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUAUGGCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGCCGCCCCCAAACCUCGAGCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA mir-219 (MIR219)
  2. Gorilla gorilla microRNA ggo-mir-219 precursor
2D structure Publications