Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1278 URS0000171FEC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1278: Hsa-mir-1278 is a microRNA that has been observed more clearly than other microRNAs in various studies [PMC9604420]. It is one of the six miRNAs that overlap across different databases [PMC8733664]. In a study, hsa-mir-1278 was identified as one of the miRNAs involved in five ceRNA regulatory axes, along with other miRNAs and hub genes [PMC9817690]. However, in more than half of the samples analyzed, the expression values of hsa-mir-1278 were zero, making it impossible to divide them into high- and low-expression groups for further analysis [PMC9817690]. In another study, hsa-mir-1278 was identified as one of the top down-regulated DEmiRNAs [PMC9814319]. It has also been mentioned as one of the potential downstream targets for circRBPMS in a bioinformatics analysis [PMC7868720]. Overall, hsa-mir-1278 is a microRNA that has been observed and studied in various contexts. However, its expression levels and functional roles may vary depending on the specific study. Further research is needed to fully understand its significance and potential implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUACUGUGCAUAUCAUCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications